The same DNA sequence template can produce different protein/peptide sequences as a result of different forward and reverse open-reading frames. Translate the below DNA sequence into all possible peptide sequences and answer the below questions. Do not consider the start codon Methionine as part of the final peptide sequence.
Input non-mitochondrial human DNA sequence in FASTA format:
>myseq ATGGCACGTTTACGATCGTACTGAAGCGTACTGATGCGTACGATCGTACGTTTAACTGATGCGTAGCTGATGCGTTACTG ACGTAGCGTAGTTTAGCGTAGCGTATGCTAACGCGTATCGTACGTTGATGCGTACTGATGCGTTTAGCGTACTGTAGCGT ACTAGCGTACGTAAA